microRNAer – små molekyler med stort potentiale

Publiceret April 2009

Introduktion og evolution

Måske har kreationisterne ret!? Nogle få, tilfældige mutationer i nogle få tusinde gener kan ikke forklare de enorme, fænotypiske forskelle, der er mellem så forskellige arter som mennesker og rundorme, medmindre … vi også læser mellem linjerne i livets bog, eller rettere: mellem generne i en organismes DNA (Figur 1).

Det er i de ikke-kodende regioner (introns) mellem de protein-kodende områder (exons), at vi finder transkripter for ncRNA, herunder miRNA.
Figur 1. Det er i de ikke-kodende regioner (introns) mellem de protein-kodende områder (exons), at vi finder transkripter for ncRNA, herunder miRNA.

Det er nemlig her, mellem de protein-kodende områder (exons), dvs. i de ikke-protein-kodende regioner (herunder introns), at vi oftest finder transkripter for non-protein-coding RNA (ncRNA), herunder gruppen af microRNA (miRNA)-molekyler. Det viser sig nemlig, at langt størstedelen af det humane genom transkriberes til RNA, hvorimod under 2 % af dette RNA translateres videre til proteiner. Hvor man tidligere afskrev ncDNA som ”junk-DNA” uden nogen vital funktion, så er der i dag evidens for, at især miRNAer spiller en nøglerolle i reguleringen af centrale, biologiske processer som cellevækst, vævsdifferentiering og apoptose, samt for evolutionen af fænotypisk diversitet. Faktisk repræsenterer miRNAerne et brud – måske endda et paradigmeskift – på molekylærbiologiens centrale dogme, som det blev defineret af Francis Crick i 1958:at den genomiske informationsstrøm er uni-direktionel: DNA → RNA → protein, idet vi nu ved, at en fraktion af transkriptomet regulerer sig selv (Figur 2) og i realiteten udgør et enormt, komplekst, regulatorisk netværk, som vi kun lige har set en flig af.

Molekylærbiologiens centrale dogme - modificeret med regulerende RNA molekyler
Figur 2. Molekylærbiologiens centrale dogme - modificeret med regulerende RNA molekyler. Det er nu ikke længere kun proteinerne, som har regulatorisk funktion. Figur: Morten Lindow.

Men tilbage til spørgsmålet: Hvor vigtigt er ncDNA for evolutionen? Ser man på forholdet mellem en organismes ncDNA (som koder for ncRNA) og dens totale genomiske DNA (tgDNA), så tegner der sig et interessant mønster, idet ncRNA/tgDNA-forholdet stiger markant med stigende cellulær kompleksitet – fx fra prokaryot til eukaryot til vertebrat – og nærmer sig 1 for mennesket (Figur 3). Det tyder på, at ncRNA-molekyler indgår i genregulatoriske systemer, der er nødvendige for udvikling af komplekse, højere organismer (1;2). Evolutionsmæssigt synes det også mere ”økonomisk” at kunne regulere og fintune genekspression ved hjælp af små, hurtige miRNA-molekyler frem for ved hjælp af store, komplekse proteiner.

Figur der viser at fraktionen af ncRNA stiger med evolutionær tid og organismens kompleksitet
Figur 3. Fraktionen af ncRNA stiger med evolutionær tid og organismens kompleksitet. Efter John S Mattick. RNA regulation: a new Genetics? Nat Rev Gen 2004; 5: 316-322.

Hvad er miRNA?

Hvad er så miRNA molekyler for nogen størrelser? Som navnet antyder, er de små: 18-25 nukleotider lange, enkeltstrengede RNA molekyler, som er udtrykt i mange, men ikke alle, eukaryote celler. Det første miRNA, lin-4 (med sekvensen UCCCUGAGACCUCAAGUGUGA) blev fundet i C. elegans i 1993 af Victor Ambros gruppe på Harvard (3). De fandt, at lin-4 var komplementært til lin-14 genet i dettes 3’-UTR (untranslated region), og ved baseparring mellem lin-4 og lin-14 bliver sidstnævnte gen ikke udtrykt, dvs. der er tale om post-transkriptionel gen ”silencing”.

Siden da har man fundet i hundredevis af miRNAer. De miRNAer, som man opdagede først , er evolutionært meget konserverede, dvs. den samme sekvens er bevaret mellem vidt forskellige organismer som orme og mennesker, hvilket indikerer, at det også er fundamentale, konserverede biologiske processer, der bliver reguleret af dem (4). Nu hvor de højt udtrykte og dybt konserverede miRNAer er identificeret, er man begyndt at finde mere specialiserede miRNAer, som ofte er lavere og sjældnere udtrykt, og som ikke er så evolutionært konserverede. Det tyder på, at der finder udvikling af nye miRNAer sted, og vi tror, at miRNAer er særdeles aktive medspillere i evolutionen.

Hvor kommer de fra?

Figur 4 viser miRNA biogenesen, som starter i cellekernen, hvor 100-1000+ nukleotider lange precursor-molekyler, pri-miRNA’er, bliver syntetiseret ved hjælp af RNA polymerase II ud fra genomisk DNA. De lange pri-miRNA bliver dernæst spaltet af Drosha, en RNAse III endonuklease, til kortere, typisk 70 nukleotider lange precursor miRNA’er (pre-miRNA) med en karakteristisk ”stem-loop” sekundær-struktur. Pre-miRNA forlader kernen gennem Exportin-5, og i cytoplasmaet klippes loop-regionen af Dicer, så en miRNA dupleks bliver tilbage. Den ene streng i dupleksen er det mature miRNA, som indgår i proteinkomplekset RISC (RNA induced silencing complex), mens den anden miR* (stjerne) streng formentlig bliver nedbrudt (5). I planter er der oftest næsten perfekt komplementaritet mellem en miRNA og dens target mRNA, hvilket fører til nedbrydning af mRNA strengen, mens der i animalske celler oftest kun er partiel komplementaritet mellem miRNA og 3’-UTR, hvilket medfører blokering af translation, men ikke nødvendigvis nedbrydning af mRNAet.

miRNA biogenese. Klik for en større version
Figur 4. miRNA biogenese. I cellekernen spaltes pri-miRNA til pre-miRNA, som i cytoplasmaet kløves til det mature miRNA. Dette inkorporeres i RISC (RNA induced silencing complex), som blokerer translation af RNA (ved imperfekt match til target) eller medfører nedbrydning af mRNA (ved perfekt match, typisk i planter). Større version.

De flestes miRNAer kan inddeles i familier baseret på sekvenslighed, og visse familier, som fx miR-17-92 clusteren er opstået som følge af gen-duplikation (6). Den biologiske effekt på et mRNA kan derfor være redundant og additiv (når miRNA familiemedlemmerne ligner hinanden meget), men effekten kan også være differentieret og rettet mod mange forskellige mRNAer (når medlemmerne i miRNA-familien er meget forskellige og udtrykt til forskellig tid og sted) med en resulterende kooperativ fænotype (7). Da hvert miRNA kan have mange forskellige mRNA targets, og hver mRNA kan reguleres af mange forskellige miRNAer, bliver kompleksiteten af de regulatoriske netværk, hvori miRNAer indgår, enorm (Figur 5), og det anslås at mindst en tredjedel af samtlige humane gener er reguleret af miRNAer (8).

2009_2 Litman-5
Figur 5. Regulatoriske netværk: Da hver miRNA har mange targets, og hver 3'-UTR kan targeteres af mange miRNAer, bliver de regulatoriske netværk ekstremt komplekse.

Da både perfekt og ufuldstændig binding af et miRNA til dets target-mRNA kan finde sted, og fordi sekundær-strukturen af miRNA-3’UTR komplekset også spiller en rolle for stabiliteten af bindingen, er det vanskeligt præcist at identificere, hvilke gener, miRNAerne kontrollerer. Faktisk er korrekt miRNA-target-forudsigelse en af de største bioinformatiske udfordringer, hvilket afspejles i, at man typisk opnår lige så mange forskellige resultater, som der er algoritmer, og det viser sig, at der kun er lille overlap mellem de forskellige metoder. Hvad der er de ”sande” mål for et miRNA kræver eksperimentel validering, fx i form af knock-in, knock-out og mutationsstudier, immunoprecipitering samt kvantitativ proteom analyse, men ingen af disse metoder er trivielle (9;10). Forskellene i target-forudsigelse er illustreret på Figur 6, hvor vi har sammenlignet resultatet for miR-21 for tre af de gængse miRNA-target-forudsigelsesalgoritmer, miRanda, PicTar og TargetScan. Disse kan alle tilgås fra miRBase (http://microrna.sanger.ac.uk/sequences), som er en miRNA-database ved the Welcome Trust Sanger Institute, der annoterer alle miRNA-sekvenser baseret på publicerede data (11).

Sammenligning af tre forskellige algoritmer til miRNA-target-forudsigelse
Figur 6. Sammenligning af tre forskellige algoritmer til miRNA-target-forudsigelse: miRanda, TargetScan og PicTar. Kun 32 ud af over 1000 targets for miR-21 er de tre algoritmer enige om.

På Bioinformatik-centret bruger vi ”machine learning” til at udvikle en metode til forudsigelse af miRNA-targets. Til træning af denne metode bruges data fra eksperimenter, hvor en miRNA for eksempel er inhiberet med en LNA ”antimir” (12)

Hvor mange er der?

Den seneste version 12.0 af miRBase fra september 2008 indeholder 8619 sekvenser, hvoraf de 695 er humane. Det anslås, at miRNA-sekvenser udgør ca. 1-4 % af alle gener, så hvis vi regner med 30.000 gener i det humane genom, kan vi forvente at finde op mod 1200 humane miRNAer. Dette tal stemmer meget godt overens med vores egne sekventeringsstudier ved hjælp af 454 og Illumina teknologi, hvor det ser ud til at vi er ved at nå mætning, hvad angår opdagelse af nye miRNAer.

De sekvenser, der er annoteret i miRBase er typisk 22 nukleotider lange, men nye sekventeringsdata tyder på, at både 5’ og især 3’ længdevarianter, såkaldte isomiRs, kan koeksistere i samme celle (13). Den biologiske betydning af disse isomiRs diskuteres stadig, men de spiller formentlig en rolle for subcellulær lokalisering og stabilitet af miRNA-molekylerne (14).

miRNA Blå Bog:

 

1993:

lin-4 opdages i C. elegans (Victor Ambros, Harvard)

2001:

miRNA familien defineres (Victor Ambros, nu Dartmouth)

2002:

kåret som ”Årets Molekyle” af Science

2006:

Nobelprisen i medicin går til Andrew Fire og Craig Mello for opdagelsen af RNAi (Victor Ambros får en medalje af Genetics Society of America)

Hvordan finder vi dem?

Pga. deres lille størrelse har miRNAer i mange år unddraget sig forskernes opmærksomhed, primært fordi de (miRNAerne, ikke forskerne) blev vasket ud under oprensning af det ”rigtige” RNA. Først da man begyndte at interessere sig for den korte (under 25 nukleotider lange) RNA fraktion, lykkedes det at isolere og klone miRNA. I dag foregår opdagelse af nye miRNA molekyler typisk ved anvendelse af ”næste-generations” sekventeringsmetoder, som fx 454 (fra Roche), Illumina (Solexa) og SOLiD (fra ABI) kombineret med bioinformatik til identificering af de bedste miRNA-kandidater baseret på bl.a. sekundær struktur og fri energi. På Bioinformatik-centret arbejder vi med analyse af ”næste-generations” sekvensdata, hvilket indebærer en del udfordringer, blandt andet på grund af sekventeringsfejl i de korte sekvenser, og vi udvikler metoder til at finde ud af, om en kort sekvens er en miRNA eller en anden slags ikke-kodende RNA.

Når først de interessante miRNAer er identificeret, følger de næste spørgsmål af sig selv:

  1. Hvor og hvornår er de udtrykt?
  2. I hvor høj grad er de udtrykt?
  3. Hvilke gener og cellulære processer regulerer de?
  4. Hvad regulerer regulatorerne?
  5. Hvilken rolle spiller de i forskellige sygdomme? – Og kan vi gøre noget ved det?

Re 1) Spørgsmålet om lokalisering besvares bedst med in situ hybridiseringsstudier (ISH), der direkte kan visualisere specifikke miRNAer, hvis de er udtrykt i det pågældende væv (Figur 7) (15). Det har vist sig at miRNA-ekspressionen er yderst stadie- og vævsspecifik, hvilket understreger deres rolle i udviklings- og differentieringsprocesser.

ISH visualisering af miR-206 i et kyllinge-embryo ved hjælp af en LNA baseret miRNA-probe
Figur 7. ISH visualisering af miR-206 i et kyllinge-embryo ved hjælp af en LNA baseret miRNA-probe. miR-206 udtrykkes specifikt i skeletmuskelceller.

Re 2) Kvantificering af miRNA-ekspression er nok det felt, der er i kraftigst vækst, og det er da også her, at man finder det største udbud af analyseværktøjer. Disse er typisk microarrays og RT-PCR i forskellige udformninger.

På Exiqon bruger vi specielle, LNA-forbedrede microarrays, der indeholder flere tusind prober til detektion af miRNA. LNA (locked Nucleic Acids, Figur 8) er strukturelle RNA-analoger, hvor ribose-ringen har fået tilføjet en ekstra methylen-bro, som låser molekylet og hermed stabiliserer dets binding til RNA og DNA. Konsekvensen bliver, at man får en mere specifik og følsomt måling. LNA-baserede prober er ideelle for design af korte, Tm-normaliserede prober til stringente miRNA-assays, som microarrays, RT-PCR, Northern blots og ISH.

En LNA monomer
Figur 8. En LNA monomer, bemærk metylen-broen, der låser ribose konfigurationen.

RT-PCR anvendes ofte til validering af de miRNAer, som er identificeret ved den globale ekspressionsprofilering med microarrays. En væsentlig fordel ved RT-PCR metoden er, at den er meget følsom, idet man kan nøjes med at anvende helt ned til 10 pg RNA som udgangsmateriale, hvilket svarer til udbyttet fra en enkelt celle.

Re 3) Den funktionelle analyse af miRNAers biologiske rolle er nok den mest udfordrende, idet den kræver studier, hvor man først efterligner (miRmimmicks) eller hæmmer (antagomiRs) miRNAers fysiologiske rolle, og efterfølgende validerer de miRNA – samt deres potentielle targets – som man ønsker at undersøge.

Re 4) Et endnu relativt uudforsket område er studiet af, hvordan selve miRNA-ekspressionen reguleres, for udover regulering via transkriptionsfaktorer (16) er der nu evidens for endnu et lag af kompleksitet, eftersom andre ikke-kodende RNAer formentlig danner regulatoriske netværk inden for de regulatoriske miRNA netværk!

Re 5) Over halvdelen af alle miRNAer kodes i ”skrøbelige” kromosomale områder, der er associerede med forskellige former for cancer (17). Spørgsmålet er, om ændringerne i miRNA-ekspression blot er epifænomener eller en medvirkende årsag til sygdommen. Her tyder mere og mere på, at en række miRNAer, de såkaldte ”oncomiR”, spiller en direkte rolle i onkogenesen, eftersom de både kan fungere som tumor suppressor gener og som onkogener (18). Et tumor suppressor miRNA vil typisk blokere et ”ægte” onkogen; dvs. bliver det pågældende miRNA nedreguleret, mindskes den hæmmende effekt på onkogenet, som derved udtrykker sit onkoprotein (Figur 9A). Den omvendte situation gør sig gældende for et miRNA onkogen, som targeterer et ”ægte” tumor suppressor gen: opregulering af miRNAet fører til blokering af tumor suppressoren, med øget risiko for tumor-dannelse (Figur 9B). At miRNAer udgør en lovende ny klasse af diagnostiske biomarkører blev demonstreret i 2005 af Lu et al., som viste, at en molekylær signatur bestående af ca. 200 miRNAer var en tilsvarende mRNA-signatur baseret på over 20.000 gener overlegen, når det gjaldt om at klassificere svagt differentierede tumorer (19).

OncomiRs: miRNAer kan virke både som tumor suppressor molekyler og som onkogener. Klik for en større version.
Figur 9. OncomiRs: miRNAer kan virke både som tumor suppressor molekyler og som onkogener. (A) Nedregulering af et tumor suppressor miRNA medfører mindsket hæmning af onkogenet, og dermed øget produktion af onkoproteinet. (B) Opregulering af et onkogent miRNA medfører nedregulering af tumor suppressor genet og dets genprodukt. Resultat i begge tilfælde: øget risiko for tumordannelse. Større version.

Vi har på Exiqon fokus på miRNA biomarkører til cancerdiagnostik, og bruger LNA-baserede analysemetoder som in situ hybridisering, microarrays og RT-PCR til at studere miRNAers betydning i bryst-, kolon-, lunge-, prostata-, og hudkræft. Vores studier tyder på, at miRNAer har stort potentiale inden for alle grene af cancerdiagnostikken:

Diagnostisk, til tidlig identifikation af kræft, dvs. inden tumoren har metastaseret, hvilket er altafgørende for kurativ behandling inden for så godt som alle cancerformer.

Prognostisk, til at separere lav- fra høj-risiko patienter, således, at kun de patienter, som er i høj-risiko gruppen bliver behandlet, mens man undgår overbehandling af lav-risiko patienter. Vi har netop lanceret et LNA-baseret in situ hybridiserings (ISH) produkt, der ved at bestemme miR-21 ekspressionen i biopsier fra tyktarmskræft kan identificere patienter med forhøjet risiko for tilbagefald.

Prediktivt, til at forudsige, hvilke patienter der vil – eller ikke vil – have glæde af en given behandling, altså et skridt nærmere skræddersyet eller individualiseret - medicinering.

Det skal nævnes, at miRNAer også kan spille en rolle i en lang række andre sygdomme, som neurologiske lidelser, herunder Fragile X syndromet (20), skizofreni (21), Alzheimers sygdom (22;23), og andre neurodegenerative sygdomme (24) (23;25), virusinfektioner (26), diabetes (27), inflammatoriske lidelser som psoriasis (28), og kardiovaskulære sygdomme (29).

Fra præcis diagnostik til terapi er der desværre et stykke vej, og selv om vi kan afdække mulige miRNA mål for intervention, så er der stadig store udfordringer der skal overvindes i forbindelse med genterapi i praksis, herunder kontrolleret ”delivery” af lægemidlet. Et godt eksempel på at det kan lade sig gøre at udvikle miRNA- baseret medicin er miR-122 knockdown i leveren (et projekt udført af det danske biotekfirma Santaris med støtte fra Højteknologifonden), hvor man ved indgift af en LNA-antimiR var i stand til både at sænke blod-kolesterol-niveauet og beskytte mod hepatitis C infektion (30).

Det står klart, at miRNA forskningen er inde i en rivende og meget lovende udvikling, og kan være med til at opfylde vores vision om morgendagens personlige medicinering ved hjælp af avanceret genterapi. Perspektiverne indenfor såvel diagnostik som behandling er enorme, og det er kun et spørgsmål om tid, før vi har fået afdækket de vigtigste sygdomsassocierede miRNAer, deres funktion, rolle som biomarkører og potentielle targets. Når det så er sagt, må vi ikke glemme alle ”de andre” ikke-protein-kodende RNA familier: Der er formentlig tale om titusindvis af ncRNA species, herunder snRNA (small nuclear RNA) (31), snoRNA (small nucleolar RNA) (32), og den store gruppe af piRNA (Piwi-interacting RNA ) (33) molekyler, der potentielt kan interagere både med hinanden og med mRNA i et enormt, kompliceret, netværk. For at analysere og i sidste ende forstå denne komplekse systembiologi har vi brug for Bioinformatik-centerets avancerede bioinformatiske værktøjer kombineret med sofistikerede eksperimentelle metoder.

Exiqon A/S og Bioinformatik-centret ved Københavns Universitet samarbejder om miRNA-analyse.

Dette samarbejde er blandt andet støttet af Højteknologifonden.

Exiqon A/S er en førende leverandør af analyseprodukter baseret på LNATM til microRNA ekspressionsprofilering, herunder real-time PCR, microarrays, in situ hybridisering, knockdown og RNA/mRNA-isolering. Exiqon Life Sciences' kunder er typisk molekylærbiologer i de farmaceutiske, diagnostiske og agrotekniske brancher samt akademiske institutioner, som arbejder med biologisk grundforskning, forskning i sygdomme som f.eks. kræft, stofskiftesygdomme, neurologiske sygdomme og stamcelleforskning. Exiqon Diagnostics er en af de førende leverandører af cellebaseret diagnostik til valg af kræftbehandling og lancerede sin første nye molekylærprognostiske test baseret på miRNA i 2008. Exiqon Pharma Services samarbejder med medicinalindustrien om at målrette ny medicin til patientgrupper udvalgt på baggrund af miRNA-biomarkører. Læs mere på www.exiqon.com.


Bioinformatik-centret er en del af Biologisk Institut ved Københavns Universitet. Centret tilbyder en kandidat-uddannelse i bioinformatik, hvor man kan blive optaget med en bachelorgrad i et relevant naturvidenskabeligt fag (f.eks. biokemi, biologi, datalogi, fysik, eller ingeniør). Centret har ca. 25 forskere og phd studerende, som forsker i protein og RNA struktur, comparativ genomics, gen-regulering, miRNA med mere. Anders Krogh leder centret. Læs mere på www.binf.ku.dk.

Referencer

  1. Mattick JS, Makunin IV. Small regulatory RNAs in mammals. Hum Mol Genet 2005 Apr 15;14 Spec No 1:R121-R132.
  2. Mattick JS. RNA regulation: a new genetics? Nat Rev Genet 2004 Apr;5(4):316-23.
  3. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993 Dec 3;75(5):843-54.
  4. Lee CT, Risom T, Strauss WM. Evolutionary conservation of microRNA regulatory circuits: an examination of microRNA gene complexity and conserved microRNA-target interactions through metazoan phylogeny. DNA Cell Biol 2007 Apr;26(4):209-18.
  5. Wienholds E, Plasterk RH. MicroRNA function in animal development. FEBS Lett 2005 Oct 31;579(26):5911-22.
  6. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel genes coding for small expressed RNAs. Science 2001 Oct 26;294(5543):853-8.
  7. Carleton M, Cleary MA, Linsley PS. MicroRNAs and cell cycle regulation. Cell Cycle 2007 Sep 1;6(17):2127-32.
  8. Kim VN, Nam JW. Genomics of microRNA. Trends Genet 2006 Mar;22(3):165-73.
  9. Grosshans H, Filipowicz W. Proteomics joins the search for microRNA targets. Cell 2008 Aug 22;134(4):560-2.
  10. Selbach M, Schwanhausser B, Thierfelder N, Fang Z, Khanin R, Rajewsky N. Widespread changes in protein synthesis induced by microRNAs. Nature 2008 Sep 4;455(7209):58-63.
  11. Griffiths-Jones S, Saini HK, van DS, Enright AJ. miRBase: tools for microRNA genomics. Nucleic Acids Res 2008 Jan;36(Database issue):D154-D158.
  12. Frankel LB, Christoffersen NR, Jacobsen A, Lindow M, Krogh A, Lund AH. Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem 2008 Jan 11;283(2):1026-33.
  13. Morin RD, O’Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, et al. Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Genome Res 2008 Apr;18(4):610-21.
  14. Li J, Yang Z, Yu B, Liu J, Chen X. Methylation protects miRNAs and siRNAs from a 3’-end uridylation activity in Arabidopsis. Curr Biol 2005 Aug 23;15(16):1501-7.
  15. Wienholds E, Kloosterman WP, Miska E, varez-Saavedra E, Berezikov E, de BE, et al. MicroRNA expression in zebrafish embryonic development. Science 2005 Jul 8;309(5732):310-1.
  16. Shalgi R, Lieber D, Oren M, Pilpel Y. Global and local architecture of the mammalian microRNA-transcription factor regulatory network. PLoS Comput Biol 2007 Jul;3(7):e131.
  17. Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A 2004 Mar 2;101(9):2999-3004.
  18. Esquela-Kerscher A, Slack FJ. Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer 2006 Apr;6(4):259-69.
  19. Lu J, Getz G, Miska EA, varez-Saavedra E, Lamb J, Peck D, et al. MicroRNA expression profiles classify human cancers. Nature 2005 Jun 9;435(7043):834-8.
  20. Jin P, Zarnescu DC, Ceman S, Nakamoto M, Mowrey J, Jongens TA, et al. Biochemical and genetic interaction between the fragile X mental retardation protein and the microRNA pathway. Nat Neurosci 2004 Feb;7(2):113-7.
  21. Beveridge NJ, Tooney PA, Carroll AP, Gardiner E, Bowden N, Scott RJ, et al. Dysregulation of miRNA 181b in the temporal cortex in schizophrenia. Hum Mol Genet 2008 Apr 15;17(8):1156-68.
  22. Wang WX, Rajeev BW, Stromberg AJ, Ren N, Tang G, Huang Q, et al. The expression of microRNA miR-107 decreases early in Alzheimer’s disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J Neurosci 2008 Jan 30;28(5):1213-23.
  23. Cogswell JP, Ward J, Taylor IA, Waters M, Shi Y, Cannon B, et al. Identification of miRNA changes in Alzheimer’s disease brain and CSF yields putative biomarkers and insights into disease pathways. J Alzheimers Dis 2008 May;14(1):27-41.
  24. Bilen J, Liu N, Burnett BG, Pittman RN, Bonini NM. MicroRNA pathways modulate polyglutamine-induced neurodegeneration. Mol Cell 2006 Oct 6;24(1):157-63.
  25. Bushati N, Cohen SM. microRNAs in neurodegeneration. Curr Opin Neurobiol 2008 Aug 5.
  26. Browne EP, Li J, Chong M, Littman DR. Virus-host interactions: new insights from the small RNA world. Genome Biol 2005;6(11):238.
  27. Tang X, Tang G, Ozcan S. Role of microRNAs in diabetes. Biochim Biophys Acta 2008 Nov;1779(11):697-701.
  28. Sonkoly E, Stahle M, Pivarcsi A. MicroRNAs and immunity: novel players in the regulation of normal immune function and inflammation. Semin Cancer Biol 2008 Apr;18(2):131-40.
  29. Latronico MV, Catalucci D, Condorelli G. Emerging role of microRNAs in cardiovascular biology. Circ Res 2007 Dec 7;101(12):1225-36.
  30. Elmen J, Lindow M, Schutz S, Lawrence M, Petri A, Obad S, et al. LNA-mediated microRNA silencing in non-human primates. Nature 2008 Apr 17;452(7189):896-9.
  31. Marz M, Kirsten T, Stadler PF. Evolution of Spliceosomal snRNA Genes in Metazoan Animals. J Mol Evol 2008 Nov 22.
  32. Hertel J, Hofacker IL, Stadler PF. SnoReport: computational identification of snoRNAs with unknown targets. Bioinformatics 2008 Jan 15;24(2):158-64.
  33. Kim VN. Small RNAs just got bigger: Piwi-interacting RNAs (piRNAs) in mammalian testes. Genes Dev 2006 Aug 1;20(15):1993-7.